View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14118_low_31 (Length: 269)
Name: NF14118_low_31
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14118_low_31 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 3806850 - 3806599
Alignment:
| Q |
18 |
atgttgcgtttgaaatgaatgttaaactcatctttccaacaaagcg-tcctgtgaaatattttgagataaattttgtatacttaactatcattttactta |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3806850 |
atgttgcgtttgaaatgaatgttaaacccatctttccaacaaagcggtcctgtgaaatattttgagataaattttgtatacctaactatcattttactta |
3806751 |
T |
|
| Q |
117 |
atttgttaggtttggttcggcccccatatttttgttttgctattcttttttattagcaatatcacgagattcattcgacacactgttttgtgatgtcgtt |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3806750 |
atttgttaggattggttcggcccccatatttttgttttgctattcttttttattagcaatatcacgagattcattcgacacactgttttgtgatgtcgtt |
3806651 |
T |
|
| Q |
217 |
ataagtgaatatcaaaagattgtattacattgtgaactgggtttgtcaacatg |
269 |
Q |
| |
|
| |||||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
3806650 |
acaagtgaatatcaaaagattgcattacagtgtgaactggg-ttgtcaacatg |
3806599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University