View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14118_low_33 (Length: 262)
Name: NF14118_low_33
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14118_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 30428536 - 30428459
Alignment:
| Q |
1 |
aaacattatggttgagcggtttccttttgttatcccttttcttttagggttgagtttgggtcagacttctttggagtg |
78 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
30428536 |
aaacattatggttgagccgtttccttttgttatcccttttcttttaggggtgactttgggtcaggcttctttggagtg |
30428459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 213 - 252
Target Start/End: Complemental strand, 30428342 - 30428303
Alignment:
| Q |
213 |
tcttggtttttcgaattccaatctcaacaataatcctttg |
252 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30428342 |
tcttggttttttgaattccaatctcaacaataatcctttg |
30428303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University