View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14118_low_45 (Length: 221)
Name: NF14118_low_45
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14118_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 99 - 205
Target Start/End: Complemental strand, 4198987 - 4198881
Alignment:
| Q |
99 |
atgcatttaatatgtacacactagtacaaacacaatcacaccgttgatgaatattttcaagtactaacatttaataaacttcattaaatatttttaacta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4198987 |
atgcatttaatatgtacacactagtacaaacacaatcacaccgttgatgaatattttcaagtactaacatttaataaacttcattaaatatttttaacta |
4198888 |
T |
 |
| Q |
199 |
ggagtat |
205 |
Q |
| |
|
||||||| |
|
|
| T |
4198887 |
ggagtat |
4198881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University