View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1411R-Insertion-10 (Length: 254)
Name: NF1411R-Insertion-10
Description: NF1411R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1411R-Insertion-10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 8 - 254
Target Start/End: Original strand, 28610927 - 28611170
Alignment:
| Q |
8 |
acaaatagtaatgaaactgcaaagaatgaacacagatagcagaatgctatttcttgataacttcggataaatttcagcagctttttgtgatcacttcatt |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| || |||||||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
28610927 |
acaaatagtaatgaaattgcaaagaatgaacatggatagcagaatgccatgtcttgataactttggtaaaatttcagtagctttttgtgatcacttcatt |
28611026 |
T |
 |
| Q |
108 |
caccgaatataaaatcccatgaaattttcttaaatttgaacataaagggcatattttgttcctaaattatattattttctccaagaaacgtgtcaaagac |
207 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||||||| ||| ||||||||| ||||| ||||||| ||| |||| ||| |||||||||||| |
|
|
| T |
28611027 |
caccgaata--aaatcccatgaa-ttttctaaaatttgaacataaatggcgtattttgttactaaactatattactttttccaggaaccgtgtcaaagac |
28611123 |
T |
 |
| Q |
208 |
aatgaattctataacatatggttgaattactgattttgtttgccttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
28611124 |
aatgaattctataacatatggttgaattcatgatattgtttgccttt |
28611170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University