View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1411R-Insertion-12 (Length: 118)
Name: NF1411R-Insertion-12
Description: NF1411R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1411R-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 9 - 118
Target Start/End: Original strand, 37697018 - 37697127
Alignment:
| Q |
9 |
tggatatgctcctccaggaagtggatttgtttgtgtttgtaaaagtggatataatactagccttgattgctctaattacgatcaaaaccaggatttcctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37697018 |
tggatatgctcctccaggaagtggatttgtttgtgtttgtaaaagtggatataatactagccttgattgctctaattacgatcaaaaccaggatttcctt |
37697117 |
T |
|
| Q |
109 |
tgggactcca |
118 |
Q |
| |
|
|||||||||| |
|
|
| T |
37697118 |
tgggactcca |
37697127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University