View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1411_low_17 (Length: 246)
Name: NF1411_low_17
Description: NF1411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1411_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 28607262 - 28607498
Alignment:
| Q |
1 |
aaggtccaatttaggggatcaatctaattgttcattagtgaaaggtgacaaattaaagctttgcgtagattatcccacataaactagtgtcaaggggatt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28607262 |
aaggaccaatttaggggatcaatctaattgttcattagtgaagggtgacaaattaaagctttgcgtagattagcccacataaactagtgtcaaggggatt |
28607361 |
T |
 |
| Q |
101 |
cgaacctgtgactttgatttcttatgtcagtgtttcacaaagacatccccttgcaaaacaatgatagtccgactaacatgctatcaaattagtagacatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28607362 |
cgaacctgtgactttgatttcttatgtcagcgtttcacaaagacatccccttgcaaaacaatgatagtccgactaacatgctatcaaattagtagacatc |
28607461 |
T |
 |
| Q |
201 |
tacatcaatcaactgaaccaattagatatggcctttg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28607462 |
tacatcaatcaactgaaccaattagatatggcctttg |
28607498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University