View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14120_low_11 (Length: 314)
Name: NF14120_low_11
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14120_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 43804637 - 43804932
Alignment:
| Q |
1 |
tttcaacagaagtctttcattaccggcatgaattgagtttagcagaaggggttagactcctacatcgtgttaaactaagatttatatttagttgtgagag |
100 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| |||||| |||| |||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43804637 |
tttcaatagaagtcttccattaccggcatgaattgagtctagcaggagggattagactc-tacatcgtgttgaactaagatttatatttagttgtgagag |
43804735 |
T |
 |
| Q |
101 |
ataatcatatttaatgtccaacatgtctcaaataagattacttatggtggaagaattacgtggaaaaccgagtaaaacttccatttttcttcagttgagc |
200 |
Q |
| |
|
|||| |||||||||| | | |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43804736 |
ataaccatatttaatattcgacatatctcaaataagattacttatggtggaagaattacgtggaaaaccgagaaaaacttccatttttcttcagttgagc |
43804835 |
T |
 |
| Q |
201 |
aaattagtctcaacattggtgttatagatttatagttacgttgccaacgtaacataattaagctgatgtagatcacagttttttacgtggtaagagt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43804836 |
aaattagtctcaacattggtgttatagatttatagttacgttgctaacgtaacataattaagctgatgtagatcgcagttttttacgtggtaagagt |
43804932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University