View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14120_low_14 (Length: 250)
Name: NF14120_low_14
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14120_low_14 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 29445477 - 29445726
Alignment:
| Q |
1 |
taatctgaaagattcaaccttttgcatatatttgaaaattggaattgatttctcaacccaagaaaaaataaccgtttagataattagaagaaaaatgtaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29445477 |
taatctcaaagattcaaccttttgcatatatttgaaaattggaattgatttctcaacccaagaaaaaataaccgtttagataattagaagaaaaatgtaa |
29445576 |
T |
|
| Q |
101 |
tataaccaaaaacaatatcaatatatgatgaatgacttgaaagaaaagctatctagcaaggcaatagatatgtttttacccttgtttgaaatgccatcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29445577 |
tataaccaaaaacaatatcaatatatgatgaatgacttgaaagaaaagctatctagcaagggaatagatatgtttttacccatgtttgaaatgccatcct |
29445676 |
T |
|
| Q |
201 |
gataaatttgctgcttttgagagtgcacttctccatttacttattttttc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29445677 |
gataaatttgctgcttttgagagtgcacttctccatttacttattttttc |
29445726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University