View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14120_low_17 (Length: 228)
Name: NF14120_low_17
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14120_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 8402834 - 8402638
Alignment:
| Q |
13 |
gcagagagcagctagtatgccaactaaaaagggtttcactttaacaacatgattcttcgttccattgaatataaaacacatgattcatcgtttcataatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8402834 |
gcagagagcagctagtatgccaactaaaaagggtttcactttaacaacatgattcttcgttccattgaatataaaacacatgattcatcgtttcataact |
8402735 |
T |
|
| Q |
113 |
atgcagtaattgaacaatggtcgatctagcaataagtggtttagcaatgccagtaattgctcacaagcctgcttgcttaattgggttgagtaggagt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402734 |
atgcagtaattgaacaatggtcgatctagcaataagtggtttagcaatgccagtaattgctcacaagcctgcttgcttaattgggttgagtaggagt |
8402638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University