View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14120_low_18 (Length: 217)

Name: NF14120_low_18
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14120_low_18
NF14120_low_18
[»] chr1 (1 HSPs)
chr1 (74-201)||(30630192-30630319)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 74 - 201
Target Start/End: Complemental strand, 30630319 - 30630192
Alignment:
74 atcatttctcaaggttgaatggagtaagtagcattggagtaatggccaaccctttgatttcgaaccttctaatagatgagttgcccacgtttctataatg 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30630319 atcatttctcaaggttgaatggagtaagtagcattggagtaatggccaaccctttgatttcgaaccttctaatagatgagttgcccacgtttctataatg 30630220  T
174 tttctttgactcacgtgccaaccctttg 201  Q
    ||||||||||||||||||||||||||||    
30630219 tttctttgactcacgtgccaaccctttg 30630192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University