View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14120_low_19 (Length: 212)
Name: NF14120_low_19
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14120_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 43804571 - 43804465
Alignment:
| Q |
1 |
tgttaatacacatcctaaaatcacttgtcagtgaactaaatatggaaacattgtattggattggannnnnnnnaatcaaaaacattgtattaaaagctgt |
100 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43804571 |
tgttaatacacaccctaaaaacacttgtcagtgaactaaatatggaaacattgtattggattgga-tttttttaatcaaaaacattgtattaaaagctgt |
43804473 |
T |
|
| Q |
101 |
gttcaagc |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
43804472 |
gttcaagc |
43804465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 146 - 184
Target Start/End: Complemental strand, 43804426 - 43804388
Alignment:
| Q |
146 |
agacaattatatttttgaaatccttaacaaatgccaaaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43804426 |
agacaattatatttttgaaatccttaacaaatgccaaaa |
43804388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University