View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14120_low_9 (Length: 328)
Name: NF14120_low_9
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14120_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 12 - 313
Target Start/End: Complemental strand, 41277976 - 41277675
Alignment:
| Q |
12 |
tattcttatgtggttgcattttgcttcctctgtctttggtggttctactgtgctctttaagtttgaggtaagtgattatttatcattcttgctaatttat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277976 |
tattcttatgtggttgcattttgcttcctctgtctttggtggttctactgcgctctttaagtttgaggtaagtgattatttatcattcttgctaatttat |
41277877 |
T |
|
| Q |
112 |
gctacaaacttagtgaaaatgtattatggtacctattttatcctatatgcctatgaataaaataccttactgaggtcttgcttgctggtttgcagttgta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277876 |
gctacaaacttagtgaaaatgtattatggtacctattttatcctatatgtctatgaataaaataccttactgaggtcttgcttgctggtttgcagttgta |
41277777 |
T |
|
| Q |
212 |
ttttgggcttttggtgtttgtgggttatgttgtagtagacacccaagaaataattgaaaggagccaaaatgctcctatactacactgaaattggtggtaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277776 |
ttttgggcttttggtgtttgtgggttatgttgtagtagacacccaagaaataattgaaaggagccaaaatgctcctatactacactgaaattggtggtaa |
41277677 |
T |
|
| Q |
312 |
at |
313 |
Q |
| |
|
|| |
|
|
| T |
41277676 |
at |
41277675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 200 - 268
Target Start/End: Original strand, 4214238 - 4214306
Alignment:
| Q |
200 |
tttgcagttgtattttgggcttttggtgtttgtgggttatgttgtagtagacacccaagaaataattga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||| |||| |
|
|
| T |
4214238 |
tttgcagttgtattttgggcttttggtgtttgtgggttacattgtagtagacacgcaggaaatagttga |
4214306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University