View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14121_high_22 (Length: 231)
Name: NF14121_high_22
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14121_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 53562358 - 53562552
Alignment:
| Q |
20 |
tttgggaagattaaagttgccggcgtttttgttctacgagtggacgtggaatcccaaggactgtttgatgcggtgaggttgttttgtttgggagagctgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53562358 |
tttgggaagattaaagttgccggcgtttttgttctacgagtggaagtggaatcccaaggactgtttgatgcggtgaggttgttttgtttgggagagctgc |
53562457 |
T |
 |
| Q |
120 |
tgctgcgtggtgtctggctgtgttcattgaggttgtgcagttctgttgtggtgctgctggtttttctgtttgcagcagctcttatgctttctgtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53562458 |
tgctgcgtggtgtctggctgtgttcattgaggctgtgcagttctgttgtggtgctgctggtttttctgtttgcagcagctcttatgctttctgtg |
53562552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University