View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14121_high_22 (Length: 231)

Name: NF14121_high_22
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14121_high_22
NF14121_high_22
[»] chr4 (1 HSPs)
chr4 (20-214)||(53562358-53562552)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 53562358 - 53562552
Alignment:
20 tttgggaagattaaagttgccggcgtttttgttctacgagtggacgtggaatcccaaggactgtttgatgcggtgaggttgttttgtttgggagagctgc 119  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53562358 tttgggaagattaaagttgccggcgtttttgttctacgagtggaagtggaatcccaaggactgtttgatgcggtgaggttgttttgtttgggagagctgc 53562457  T
120 tgctgcgtggtgtctggctgtgttcattgaggttgtgcagttctgttgtggtgctgctggtttttctgtttgcagcagctcttatgctttctgtg 214  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53562458 tgctgcgtggtgtctggctgtgttcattgaggctgtgcagttctgttgtggtgctgctggtttttctgtttgcagcagctcttatgctttctgtg 53562552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University