View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14121_high_6 (Length: 501)
Name: NF14121_high_6
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14121_high_6 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 147; Significance: 3e-77; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 329 - 499
Target Start/End: Original strand, 79699 - 79869
Alignment:
| Q |
329 |
aagaattcctgcagaaagaagatgcacctgcagatgttgctgtcccaacagcaaatttccatcagcgaaatggatctcgaaattcccgtgggcgaggttc |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
79699 |
aagaattcctgcagaaagaagatgcacctgcagatgttgctgtcccaatagcaaatttccatcagcgaaatggatctcgaaattcccgtgggcgaggttc |
79798 |
T |
 |
| Q |
429 |
ttttcgtcgaggcggtcgtcatggatcaaaccataatatgaatccttttccagcagattcatctcactcga |
499 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
79799 |
ttttcgtccaggcggtcgtcatggatcaaaccaaaatatgaatccttttccaacagattcattccactcga |
79869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University