View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14121_low_21 (Length: 253)
Name: NF14121_low_21
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14121_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 158 - 247
Target Start/End: Complemental strand, 24580246 - 24580157
Alignment:
| Q |
158 |
tcttttcagatgcgattacaacacaccacacgtcgtcgttttagatccaatcacagcagtaccacaacacatcacacgccttcatctcag |
247 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
24580246 |
tcttttcaaatgcgattacaacacaccacacgtcgtcgttttagatccaatcacagcagtaccacaacacatcacacaccatcatttcag |
24580157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 24580403 - 24580314
Alignment:
| Q |
1 |
ttcaccgaccgactgccactgccgccgccccgccaccaccatcatcatcacgcattctcttcctcaccacaactgttttccccatcaccg |
90 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
24580403 |
ttcaccgactgactgccgctgccaccgccccgccaccaccatcatcatcacgcattctcttcctcaccacgactgtttttcccatcaccg |
24580314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University