View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14121_low_28 (Length: 226)
Name: NF14121_low_28
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14121_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 39620413 - 39620203
Alignment:
| Q |
1 |
ttctttatttgtttgaggtgtgatcctaatacggttgttcacaagaccagacgccatacctcttctacttcgtcctgcgcttctgtttctcttattctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39620413 |
ttctttatttgtttgaggtgtgatcctaatacggttgttcacaagaccagacgccatacctcttcttcttcgtcctgcgcttctgtttctcttattctgc |
39620314 |
T |
 |
| Q |
101 |
aactacttcaatccttctatcttattttgtttttggttcctcgtttttctattgacagtgtgtgtgagagagactcaaggtgcaattctaatttttcacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
39620313 |
aactacttcaatccttctatcttattttgtttttgcttcctcgtttttctgttgacagtgtgtgtgtgagagactcaaggtgcaattctaattttccacg |
39620214 |
T |
 |
| Q |
201 |
ggattcaaaac |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
39620213 |
ggattcaaaac |
39620203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 28955985 - 28956175
Alignment:
| Q |
23 |
atcctaatacggttgttcacaagaccagacgccatacctcttctacttcgtcctgcgcttctgtttctcttattctgcaactacttcaatccttctatct |
122 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||||||| ||||||| |||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28955985 |
atcctaatacagttgttcgcaagaccagacgccgtacctcttcttcttcgtcttgcgcttctgtttctcttattcagtaactacttcaatccttctatct |
28956084 |
T |
 |
| Q |
123 |
tattttgtttttggttcctcgtttttctattgacagtgtgtgtgagagag--actcaaggtgcaattctaatttttcacgggattcaaaac |
211 |
Q |
| |
|
|||||| |||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
28956085 |
tattttatttttgcttcctcatttttctattgacagtgtgtgtgagagagaaactcaaggtgcaatactaatttttcagggggttcaaaac |
28956175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 61 - 211
Target Start/End: Complemental strand, 12805104 - 12804952
Alignment:
| Q |
61 |
tcttctacttcgtcctgcgcttctgtttctcttattctgcaactacttcaatccttctatcttattttgtttttggttcctcgtttttctattgacagtg |
160 |
Q |
| |
|
|||||| ||| ||| ||| ||| |||||||||| ||| ||||||||||||||||||| ||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
12805104 |
tcttcttctttgtcatgcccttttgtttctctttttcagcaactacttcaatccttccatcttcttttgtttttgctttctcgtttttctattgacagtg |
12805005 |
T |
 |
| Q |
161 |
tgtgtgagagag--actcaaggtgcaattctaatttttcacgggattcaaaac |
211 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| | | |||||||| |
|
|
| T |
12805004 |
tgtgtgagagagaaactcaaggtgcaacactaatttttcaggaggttcaaaac |
12804952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University