View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14121_low_9 (Length: 437)
Name: NF14121_low_9
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14121_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 430
Target Start/End: Original strand, 38727145 - 38727535
Alignment:
| Q |
18 |
gaaagggcttacttacatgagtattttaaatatttaatgcatgctctagtgtgctggaatcatgactgatagtaaattaaaatattcagttgtttgactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38727145 |
gaaagggcttacttacatgagtattttaaatatttaatgcatgctctagtgtgctggaatcatgactgatagtaaattaaaatatt-------------- |
38727230 |
T |
 |
| Q |
118 |
tgagattattttggctgtgcgatacaatatctatatgtactgtaggctcgcttagtggatttcatctagtccnnnnnnnnnnnnnnnatatagggatcac |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
38727231 |
-------attttggctgtgcaatacaatatctatatgtactgtaggctcgcttagtggattttatctagtcctttttttctttttt-atatagggatcac |
38727322 |
T |
 |
| Q |
218 |
tacactagtgggaggaggaacaggaccagcagatggaacgcgtgctacaacttgcacaccggcacctaatcagatgcaaatgatgctgcaatcaacagat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38727323 |
tacactagtgggaggaggaacaggaccagcagatggaacgcgtgctacaacttgcacaccggcacctaatcagatgcaaatgatgctgcaatcaacagat |
38727422 |
T |
 |
| Q |
318 |
gacctgcctctgaactttggttttaatggaaaagttcgtttttcttctttgcttgtatataatgcttgttcattttcnnnnnnnngttcagttatttttc |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38727423 |
gacctgcctctgaactttggttttaatggaaaagttcgtttttcttctttgcttgtatataatgcttgttcattttcttttttttgttcagttatttttc |
38727522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University