View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14122_high_6 (Length: 464)

Name: NF14122_high_6
Description: NF14122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14122_high_6
NF14122_high_6
[»] chr1 (2 HSPs)
chr1 (107-223)||(3478423-3478540)
chr1 (339-374)||(3477402-3477437)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 5e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 3478540 - 3478423
Alignment:
107 agtgtttggttgtataaaggatgttagttttgtattattaaagtcaaa-tctacgtagnnnnnnnnctccaaattcataaataatattcagaacttttaa 205  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||| ||||  |||        |||||||||  |||||||||||||||||||||||    
3478540 agtgtttggttgtataaaggatgttaattttgtattattaaagtcaaaatctaaatagttttttttctccaaattactaaataatattcagaacttttaa 3478441  T
206 tagtcatcaaatataata 223  Q
    ||||||||||||||||||    
3478440 tagtcatcaaatataata 3478423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 374
Target Start/End: Complemental strand, 3477437 - 3477402
Alignment:
339 ccaatagtcaaattagctttcagcagaaaatgatca 374  Q
    ||||||||||||||||||||||| ||||||||||||    
3477437 ccaatagtcaaattagctttcaggagaaaatgatca 3477402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University