View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14122_high_6 (Length: 464)
Name: NF14122_high_6
Description: NF14122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14122_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 5e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 3478540 - 3478423
Alignment:
| Q |
107 |
agtgtttggttgtataaaggatgttagttttgtattattaaagtcaaa-tctacgtagnnnnnnnnctccaaattcataaataatattcagaacttttaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3478540 |
agtgtttggttgtataaaggatgttaattttgtattattaaagtcaaaatctaaatagttttttttctccaaattactaaataatattcagaacttttaa |
3478441 |
T |
|
| Q |
206 |
tagtcatcaaatataata |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3478440 |
tagtcatcaaatataata |
3478423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 374
Target Start/End: Complemental strand, 3477437 - 3477402
Alignment:
| Q |
339 |
ccaatagtcaaattagctttcagcagaaaatgatca |
374 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3477437 |
ccaatagtcaaattagctttcaggagaaaatgatca |
3477402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University