View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14122_low_13 (Length: 266)
Name: NF14122_low_13
Description: NF14122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14122_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 50 - 160
Target Start/End: Complemental strand, 31166257 - 31166147
Alignment:
| Q |
50 |
actttgttgtgtgtgacaagtgaatggtttgaaattggaatttggattctataaagatatgagaaggttggagagagttatatgtttgaagataagaaga |
149 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166257 |
actttgttgtgtgtgacgagtgaatggtttgaaattggaatttggattctataaagatatgagaaggttggagagagttatatgtttgaagataagaaga |
31166158 |
T |
|
| Q |
150 |
gaaattgtcaa |
160 |
Q |
| |
|
||||||||||| |
|
|
| T |
31166157 |
gaaattgtcaa |
31166147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 189 - 255
Target Start/End: Complemental strand, 31166119 - 31166051
Alignment:
| Q |
189 |
cggagagtgacatttctttcttaatt--gcctatgattttctgtttttggcttatcccatattcttcga |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| || ||||| |
|
|
| T |
31166119 |
cggagagtgacatttctttcttaattttgcctctgtttttctgtttttggcttatcccattttattcga |
31166051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University