View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14123_high_9 (Length: 252)
Name: NF14123_high_9
Description: NF14123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14123_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 3604057 - 3603822
Alignment:
| Q |
17 |
gaagtagatggaagatatttgtgaagttgtatatgcatatcatttgtaacttctgaatataggcttaaaaacaccctctatcaagattcaagaacttgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3604057 |
gaagtagatggaagatatttgtgaagttgtatatgcatatcatttgtaacttctgaatataggcttaaaaacactctctatcaagattcaagaacttgca |
3603958 |
T |
 |
| Q |
117 |
taactgtacgtgcaaggaatcattcaaaggcaatgcccgctgtagaataatggagaagacagtgtcaaaagaagggaaacgacaaatcatatgcatagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3603957 |
taactgtacgtgcaaggaatcattcaaaggcaatgcccgctgtagaataatggagaagacagtgtcaaaagaagggaaacgacaaatcatatgcatagct |
3603858 |
T |
 |
| Q |
217 |
ggttgagtttaaaaaacaataagtaatgcatatacc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3603857 |
ggttgagtttaaaaaacaataagtaatgcatatacc |
3603822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University