View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14123_low_14 (Length: 249)
Name: NF14123_low_14
Description: NF14123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14123_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 29854002 - 29853783
Alignment:
| Q |
12 |
aggagcagagatggaaggtacgatatcaaggacagtttctttagaaaagtttgaatgtggttcttgggcttcttctgcactattcaatgacattgaaaca |
111 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29854002 |
aggatcagaaatggaaggtacgatatcaaggacagtttctttagaaaagtttgaatgtggttcttgggcttcttctgcactatttaatgacattgaaaca |
29853903 |
T |
|
| Q |
112 |
gacaacacaagttcctattttgatttaccattggaattgatcaaaggaagtagttataatgatgtacatgcacctgttacatcagcttttgtctttgaga |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29853902 |
gacaacacaagttcctattttgatctaccattggaattgatcaaaggaagtagttataatgatgtacatgcacctgttacatcagcttttgtctttgaga |
29853803 |
T |
|
| Q |
212 |
aggaccttaaaggggttctc |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29853802 |
aggaccttaaaggggttctc |
29853783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University