View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14123_low_15 (Length: 245)
Name: NF14123_low_15
Description: NF14123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14123_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 28382437 - 28382664
Alignment:
| Q |
1 |
atataatttgtcatgctcatataattatgtggaaaactctttttacaataactatttatataaattaaattcaagttgttcaagaagggtcggtccaatg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28382437 |
atataatttttcatgctcatataattatgtggaaaactctttttacaataactatttatataaattaaattcaagttgttcaagaagggtcggtccaatg |
28382536 |
T |
|
| Q |
101 |
ttatagtccttcaaattataaaatattgattattaatttttgtcnnnnnnntaatattgattattaatgtcactgatattaataataattaccccatgca |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28382537 |
t--tagtccttcaaattataaaatattgattattaatttttgtcaaaaaaataatattgattattaatgtcactgatattaataataattaccccatgca |
28382634 |
T |
|
| Q |
201 |
attttttgttttaaaattaaattcaatatt |
230 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
28382635 |
attttttattttaaaattaaattcaatatt |
28382664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University