View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14123_low_17 (Length: 241)
Name: NF14123_low_17
Description: NF14123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14123_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 7 - 211
Target Start/End: Complemental strand, 53686413 - 53686209
Alignment:
| Q |
7 |
gttagggcaatatgaagccagaaattaagataggagattaaaaagatatttaagtattttattaatgagtgatactaattataattttataacattcttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53686413 |
gttagggcaatatgaagccagaaattaagataggagattaaaaagatatttaagtattttattaatgagtgatactaattatcattttataacattcttt |
53686314 |
T |
 |
| Q |
107 |
gaatgatttgaactttgtttgttgagtttacaagattaagatccattaagttaattgatatatgaatatcgaaacaaaattgcgtaaaaacgattatttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
53686313 |
gaatgatttgaactttgtttgttgagtttccaagattaagatccattaagttaattgatatatgaatatcgaaacaaaattgcataaaaatagttatttc |
53686214 |
T |
 |
| Q |
207 |
ttgag |
211 |
Q |
| |
|
||||| |
|
|
| T |
53686213 |
ttgag |
53686209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University