View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14123_low_19 (Length: 231)
Name: NF14123_low_19
Description: NF14123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14123_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 36 - 216
Target Start/End: Original strand, 20363563 - 20363743
Alignment:
| Q |
36 |
gccaagtttcgatagtgattcattaaaatgatttaggggtcatgatagtgaatcatggttcatcacataatgtatcgggactcaagatgagattcatata |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20363563 |
gccaagtttcgatagtgattcattaaaatgatttaggggtcatgatagtgaatcatggttcatcacataatgtatcgggactcaagatgagattcatata |
20363662 |
T |
|
| Q |
136 |
tgttcaaaatcggtacaaactagaggtttgtattgataacaatgttatgaagtatatctatgatgagtactatctagttta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20363663 |
tgttcaaaatcggtacaaactagaggtttgtattgataacaatgttatgaagtatatctatgatgagtactatctagttta |
20363743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 103 - 170
Target Start/End: Complemental strand, 7057404 - 7057341
Alignment:
| Q |
103 |
taatgtatcgggactcaagatgagattcatatatgttcaaaatcggtacaaactagaggtttgtattg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| | || ||||||||||||||||||| |
|
|
| T |
7057404 |
taatgtatcgggactcaagatgagattcatattt----aaaatagatataaactagaggtttgtattg |
7057341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University