View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14124_high_18 (Length: 222)
Name: NF14124_high_18
Description: NF14124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14124_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 52 - 204
Target Start/End: Original strand, 30267636 - 30267788
Alignment:
| Q |
52 |
taccaaataccaatacccaatttggcatttcacactgtttctattgctagtaagatttaaaccataatgacactgcccaagttttgtttggtaagattta |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30267636 |
taccaaataccaatacccaatttggcatttcacactgtttctactgctagtaagatttaaaccataatgacactgcccaagttttgtttggtaagattta |
30267735 |
T |
|
| Q |
152 |
gattttggttcaaaaggaagaggtagataagagctaatagctatgctaatttc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30267736 |
gattttggttcaaaaggaagaggtagataagagctaatagctatgctaatttc |
30267788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 29364960 - 29364785
Alignment:
| Q |
15 |
cataggtatagataacccaaaatactttgttgataactaccaaataccaatacccaatttggcatttcacactgtttctattgctagtaagatttaaacc |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29364960 |
cataggtatagataaaataaaatactttgttgataactaccaaataccaataccccatttggcatttcacactgtttctattgctagtaagatttaaacc |
29364861 |
T |
|
| Q |
115 |
ataatgacactgcccaagttttgtttggtaagatttagattttggttcaaaaggaagaggtagataagagctaata |
190 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29364860 |
ataatgccaccacccaagttttttttggtaagatttagattttggttcaaaaggaagaggtagataagagctaata |
29364785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University