View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14124_high_8 (Length: 452)
Name: NF14124_high_8
Description: NF14124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14124_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 319 - 450
Target Start/End: Original strand, 36202775 - 36202906
Alignment:
| Q |
319 |
ctcaaagtgtaaacgtatctgtgaacatgcttttcaccttcttagttgcacaagttttcttgataatgctatgtcacatgaagtttggtttgttcctctt |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36202775 |
ctcaaagtgtaaacgtatctgtgaacatgcttttcaccttcttagttgcacaagttttcttgataatgctttgtcacatgaagtttggtttgttcctctt |
36202874 |
T |
 |
| Q |
419 |
ctttgccttctttgttttgatgatgtccatct |
450 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| |
|
|
| T |
36202875 |
ctttgccttctttgttttggtgatgtcaatct |
36202906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 319 - 433
Target Start/End: Complemental strand, 35922272 - 35922158
Alignment:
| Q |
319 |
ctcaaagtgtaaacgtatctgtgaacatgcttttcaccttcttagttgcacaagttttcttgataatgctatgtcacatgaagtttggtttgttcctctt |
418 |
Q |
| |
|
|||||||||| || ||||||||||||||| ||||||| ||||| ||||||||||||||||| | |||| ||||||||||||||||| ||||| |||| |
|
|
| T |
35922272 |
ctcaaagtgtcaatgtatctgtgaacatgtttttcacattctttgttgcacaagttttcttaaccctgctctgtcacatgaagtttggcttgtttatctt |
35922173 |
T |
 |
| Q |
419 |
ctttgccttctttgt |
433 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35922172 |
ctttgccttctttgt |
35922158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University