View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14124_low_13 (Length: 317)
Name: NF14124_low_13
Description: NF14124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14124_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 52796051 - 52796352
Alignment:
| Q |
1 |
aggaaaggtgccctataactaaatcaatataatcattagcagacgaagtaaatatggaatattacggggttgtgggtttggtactagccgttttggtatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796051 |
aggaaaggtgccctataactaaatcaatataatcattagcagacgaagtaaatatggaatattacggggttgtgggtttggtactagccgttttggtatg |
52796150 |
T |
 |
| Q |
101 |
gatgtggttggcaatggtgatgaaacatataagagtgaaacttggtcatcagcttccacctggaccaagatgttggccagtgattggcaacattttccag |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52796151 |
gatttggttggcaatggtgatgaaacatataagagtgaaacttggtcatcagcttccacctggaccaagatgttggccagtggttggcaacattttccag |
52796250 |
T |
 |
| Q |
201 |
ctaggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatcatgaccctttggctaggttccatgtgcaccgtagttgtct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796251 |
ctaggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatcatgaccctttggctaggttccatgtgcaccgtagttgtct |
52796350 |
T |
 |
| Q |
301 |
ct |
302 |
Q |
| |
|
|| |
|
|
| T |
52796351 |
ct |
52796352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University