View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14124_low_17 (Length: 268)
Name: NF14124_low_17
Description: NF14124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14124_low_17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 3810294 - 3810544
Alignment:
| Q |
18 |
tatatttacttaaaccctttattggagtctcttctctcaattatgttttttccatccactgtgctcaaatccaagaccttgtttaaggatctgaatccaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810294 |
tatatttacttaaaccctttattggagtctcttctcttgattatgttttttccatccactgtgctcaaatccaagaccttgtttaaggatctgaatccaa |
3810393 |
T |
|
| Q |
118 |
tttcactcgaatctacgtattgttgatattaaggtggtctaatagtctataacttcttagacagaagatttcagaatatatttatatgttaagtgataga |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810394 |
tttcactcgaatctacgtaatgttgatattaaggtggtctaatagtctataacttcttagacagaagatttcagaatatatttatatgttaagtgataga |
3810493 |
T |
|
| Q |
218 |
tatgctcacttggcattatgttcatttgtttctggtagtccttatttctgt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810494 |
tatgctcacttggcattatgttcatttgtttctggtagtccttatttctgt |
3810544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University