View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14124_low_8 (Length: 473)
Name: NF14124_low_8
Description: NF14124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14124_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 11 - 399
Target Start/End: Complemental strand, 24563658 - 24563270
Alignment:
| Q |
11 |
caaaggttgcggattttctcggtgtatgcaagtctgaaaatcattcagatcttgctacaccgaacgaaattcaatctaatgattcagattatctgtttac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563658 |
caaaggttgcggattttctcggtgtatgcaagtctgaaaatcactcagatcttgctacaccgaacgaaattcaatctaatgattcagattatctgtttac |
24563559 |
T |
|
| Q |
111 |
aaataacaatactctcatgccaatgcaaaaccaaatggttacaacatgcaccaatgagtatcaagagaaggctagtaatagtaatttgcagtctttgaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24563558 |
aaataacaatactctcatgccaatgcaaaaccaaatggttacaacatgcaccaatgagtatcaagaaaaggctagtaatagtaatttgcagtctttgaca |
24563459 |
T |
|
| Q |
211 |
ttatccatgggaagtggtaaagattcaacatgtgaaactagtggtgaaaatagtacaaacactgttgaagttgctgttcctaaaagaacttcagagacat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563458 |
ttatccatgggaagtggtaaagattcaacatgtgaaactagtggtgaaaatagtacaaacactgttgaagttgctgttcctaaaagaacttcagagacat |
24563359 |
T |
|
| Q |
311 |
ttggacaaagaacttcgatatatcgcggtgtaaccaagtagggatatttacactctatttgtcttttaatctatttaattcttgcatgc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563358 |
ttggacaaagaacttcgatatatcgcggtgtaacaaagtagggatatttacactctatttgtcttttaatctatttaattcttgcatgc |
24563270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University