View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14127_low_7 (Length: 412)
Name: NF14127_low_7
Description: NF14127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14127_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 15 - 397
Target Start/End: Original strand, 33165101 - 33165483
Alignment:
| Q |
15 |
catataacaataaaattgagaattgatctaaaattttaggaatataagtgtttctttctaggtgtgcttaaacattgtacacttgacctttatgataagc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33165101 |
catataacaataaaattgagaattgatctaacattttaggaatataagtgtttctttctaggtgtgcttaaacattgtacacttgacctttatgataggc |
33165200 |
T |
 |
| Q |
115 |
aagtatttctccaaattctaatgtaccgttaggctcttatgatgagctaattgcatgtctcaattccttgttttaaggataaatcaatttcagtttcttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33165201 |
aagtatttctccaaattctaatgtaccgttaggctcttatgatgagctaattgcatgtctcaattccttgttttaaggataaatcaatttcagtttcttt |
33165300 |
T |
 |
| Q |
215 |
tattaatctgtcttcgttttgtgtgatccttgttatgctaaatcttgagtggtgagctatacacgctttaagggaattgttgatccctttttgcatggca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33165301 |
tattaatctgtcttcgttttgtgtgatccttgttatgctaaatcttgagtggtgagctatacacgctttaagggaattgttgatccctttttgcatggca |
33165400 |
T |
 |
| Q |
315 |
aatagagggcatatctttggtaatatactcccttcaaatattatttttgaagtactggattgtttaccgtactcttttaaata |
397 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
33165401 |
aatagagggcatatctttggccatatactcccttcaaatattatttttgaagtagtggattgtttaccgtactctttcaaata |
33165483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University