View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14127_low_8 (Length: 247)
Name: NF14127_low_8
Description: NF14127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14127_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 51262682 - 51262894
Alignment:
| Q |
16 |
attatacttgaattttgattgacggttgtgggaatcaaacagggcatgaaatgaccctagcaattacaaaggtctttaatttctttctatgtaaaaacaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51262682 |
attatacttgaattttgattgacggttgtgggaatcaaacagggcatgaaatgaccctagcaattacaaaggtctttaatttctttctatgtaaaaacaa |
51262781 |
T |
|
| Q |
116 |
ctgaactagcgtactccatcataagaattcttgtactcatgtgaaacgtttagctcaagcatataatgattaaaattagggagttactataataatatgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51262782 |
ctgaactagcgtactccatcataagaattcttgtactcatgtgaaacgtttagctcaagcatataatgattaaaattagggagttactataataatatgg |
51262881 |
T |
|
| Q |
216 |
tacatctaagata |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51262882 |
tacatctaagata |
51262894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University