View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14128_low_11 (Length: 253)
Name: NF14128_low_11
Description: NF14128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14128_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 49 - 237
Target Start/End: Original strand, 14181387 - 14181575
Alignment:
| Q |
49 |
cttggtttgtattcaaacttcgaccaagtagcctggggctggtcaggtcgtctagttagctgcgctttcgtgagagtgtcttacagaagacgagaaaagc |
148 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
14181387 |
cttggtttgcattcaaacttcgaccaagtagccttcggctggtcaggtcgtccagtttactgcgctttcgtgagagtgtcttacataagacgagaatagc |
14181486 |
T |
 |
| Q |
149 |
atggagttagaagatctattttatagcaagtttgggatttcttgtgagtttgagaaaattgttgatcatcgttgaggtgatgatgattt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
14181487 |
atggagttagaagatctattttatagcaagtttggaatttcttgtgagtttgagaaaactgttgatcatcgctggggtgatgatgattt |
14181575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 14183085 - 14183138
Alignment:
| Q |
1 |
gatgcaccgaatttgtggcctgttctggatggagatagacatgttctgcttggt |
54 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14183085 |
gatgcaccgattttgtggtctgttctggatggagatagacatgttctgtttggt |
14183138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 14179235 - 14179281
Alignment:
| Q |
1 |
gatgcaccgaatttgtggcctgttctggatggagatagacatgttct |
47 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14179235 |
gatgcatcgaatttgtggtctgttctggatggagatagacatgttct |
14179281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University