View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14129_low_6 (Length: 298)
Name: NF14129_low_6
Description: NF14129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14129_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 3 - 280
Target Start/End: Original strand, 33788873 - 33789150
Alignment:
| Q |
3 |
tatcgtaactttgttgaagcttcaaaatgtactttttatcaaaatcatagcgacatatttgattcagtcaaactcaccatcaatccaatcatacacaata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33788873 |
tatcgtaactttgttgaagcttcaaaatatactttttatcaaaatcatagcgacacatttgattcagtcaaactcaccatcaatccaatcatacacaata |
33788972 |
T |
 |
| Q |
103 |
agagttgaaaatgctacatatcaagtttggtttccgcttttgtgcgagggtttgactctgattttgatgattatttgttttgttttgatggtacccctag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33788973 |
agagttgaaaatgctacatatcaagtttggtttccgcttttgtgtgagggtttgactctgattttgatggttatttgttttgttttgatggtacccctag |
33789072 |
T |
 |
| Q |
203 |
gttgagtgatgtctttataggnnnnnnngatgtaagaggcatatatattttcttttggatattctgcctatatacgac |
280 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
33789073 |
gttgagtgatgtctttataggtttttttgatgtaagaggcatatatgttttcttttggatattcggcctatatacgac |
33789150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University