View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1412_high_103 (Length: 215)

Name: NF1412_high_103
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1412_high_103
NF1412_high_103
[»] chr8 (1 HSPs)
chr8 (17-203)||(37531940-37532126)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 37532126 - 37531940
Alignment:
17 acaatgatagttggggcttctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37532126 acaatgatagttggggcttctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcag 37532027  T
117 gtgccatggggctgctcacgactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37532026 gtgccatggggctgctcacgactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt 37531940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University