View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1412_high_105 (Length: 214)

Name: NF1412_high_105
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1412_high_105
NF1412_high_105
[»] chr8 (1 HSPs)
chr8 (7-197)||(5891062-5891252)
[»] chr3 (1 HSPs)
chr3 (85-187)||(34666748-34666849)
[»] chr6 (1 HSPs)
chr6 (130-183)||(6697611-6697664)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 197
Target Start/End: Complemental strand, 5891252 - 5891062
Alignment:
7 ggtagataattctgcatagacttccaactcctgggaacttataaaagaggggaattcttggagaggatggtttgacaaattgtgtttggtgtgaggaaaa 106  Q
    ||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5891252 ggtagttatttctgcatagacttccaactcctaggaacttataaaagaggggaattcttggagaggatggtttgacaaattgtgtttggtgtgaggaaaa 5891153  T
107 tggtagaagaggcagaccgtctcttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtgggtacgtgtgtgat 197  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5891152 tggtaaaagaggcagaccgtctcttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtgggtacgtgtgtgat 5891062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 187
Target Start/End: Complemental strand, 34666849 - 34666748
Alignment:
85 attgtgtttggtgtgaggaaaatggtagaagaggcagaccgtctcttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtgg 184  Q
    ||||||||| ||||| ||||| || ||||||||| ||| | ||| ||||||| || || ||||||||  ||  |||||| |||||||||||||| |||||    
34666849 attgtgtttagtgtgtggaaa-tgatagaagaggaagatcatcttttttgtatgtatggttttgccgcatcgatttggtgtcatattttcaagttggtgg 34666751  T
185 gta 187  Q
    |||    
34666750 gta 34666748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 6697611 - 6697664
Alignment:
130 ttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtg 183  Q
    |||| |||||||| ||||||||  || |||||||||||||||||||||| ||||    
6697611 ttttataggtgtggttttgccggatcggtttggtatcatattttcaagtaggtg 6697664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University