View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_108 (Length: 213)
Name: NF1412_high_108
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 66 - 192
Target Start/End: Complemental strand, 29298374 - 29298249
Alignment:
| Q |
66 |
tatatactgttacctgaaaataacttgaattaatggattttcagttttcacatgcttgataaacattaaagtcatggattgggacataagttaataattg |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
29298374 |
tatatactgttat-tgaaaataacttgaattaatggattttcggttttcacatgcttgataaacattaaagtcatggcttaggacataagttaataattg |
29298276 |
T |
 |
| Q |
166 |
aatcttcaatacttcacttctctgcaa |
192 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
29298275 |
aatcttcaatacttcacttttctgcaa |
29298249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 102 - 193
Target Start/End: Complemental strand, 29307129 - 29307038
Alignment:
| Q |
102 |
attttcagttttcacatgcttgataaacattaaagtcatggattgggacataagttaataattgaatcttcaatacttcacttctctgcaat |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29307129 |
atttttagttttcacatgcttgataaacattaaagtcatggattgggacataagttaataattgaatcttcaatacttcacttctctgcaat |
29307038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University