View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_112 (Length: 202)
Name: NF1412_high_112
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_112 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 39 - 185
Target Start/End: Complemental strand, 43940702 - 43940556
Alignment:
| Q |
39 |
tattcattttttatatatgggaataagaataactatactattaaaatatattctcatgcaaagatttacccataaaaagatgggaaaataagagagacac |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43940702 |
tattcattttttatatatgggaataagaataactatactattaaaatatattctcatgcaaagatttacccataaaaagatgggaagataagagagacac |
43940603 |
T |
 |
| Q |
139 |
atagtcttgcggaggtgaagtagtattagagatattttcgggccaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43940602 |
atagtcttgcggaggtgaagtagtattagagatattttcgggccaaa |
43940556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University