View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_38 (Length: 332)
Name: NF1412_high_38
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 7 - 326
Target Start/End: Original strand, 29544293 - 29544614
Alignment:
| Q |
7 |
tcttatgtgaagatatatggtatacccatttgttatggttacttcaagctttgta--ttgttctttgatgtgtatttagtgcaaacacttgacgcagaac |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544293 |
tcttatgtgaagatat--ggtatacccatttgttatggttacttcaagctttgtactttgttctttgatgtgtatttagtgcaaacacttgacgcagaac |
29544390 |
T |
|
| Q |
105 |
ctgttctaagcttttggctt-----cggacttaatgttcaactgggttctttgtaccacaacaagtacaaccaagttatcgacgtgcatcaattgggttc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544391 |
ctgttctaagcttttggctttacctcggacttaatgttcaactgggttctgtgtaccacaa---gtacaaccaagttatcgacgtgcatcaattgggttc |
29544487 |
T |
|
| Q |
200 |
tttgtacttagtaactctctttccttttactgtgtgtatcaacgtgcattcttgcaatcatatgcacattgatatatgtttatgcatttattttatagca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544488 |
tttgtacttagtaactctctttccttttactgtgtgtatcaacgtgcattcttgcaatcatatgcacattgatatatgtttatgcatttattttatagca |
29544587 |
T |
|
| Q |
300 |
ggatgaactagaaattatttcttatca |
326 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29544588 |
ggatgaactagaaattatttcttatca |
29544614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 286
Target Start/End: Original strand, 29535122 - 29535195
Alignment:
| Q |
213 |
actctctttccttttactgtgtgtatcaacgtgcattcttgcaatcatatgcacattgatatatgtttatgcat |
286 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||| ||||||||| || ||||||||||||| ||||| |
|
|
| T |
29535122 |
actctctttccttctactgtgtttatcaacgtgcattcttgtaatcatatgaaccttgatatatgtttttgcat |
29535195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 116 - 161
Target Start/End: Original strand, 29535035 - 29535080
Alignment:
| Q |
116 |
ttttggcttcggacttaatgttcaactgggttctttgtaccacaac |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29535035 |
ttttggcttcagacttaatgttcaactgggttctttttaccacaac |
29535080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Original strand, 29535224 - 29535261
Alignment:
| Q |
284 |
catttattttatagcaggatgaactagaaattatttct |
321 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
29535224 |
catttattttattgcaggatgaactagaaattacttct |
29535261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University