View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_39 (Length: 329)
Name: NF1412_high_39
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 40076637 - 40076325
Alignment:
| Q |
1 |
tgtttttggaaccaaatttggttgccatgggtgaattgtatgaatgtttgtgaactcttgggaatatgaatgctattttaagggtgattttttgatgggt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40076637 |
tgtttttggaaccaaatttgggtgccatgggtgaattgtatgaatgtttgtgaactcttgggaatatgaatgctattttaagggttatttttttatgggt |
40076538 |
T |
 |
| Q |
101 |
ggcgtatgaagatgtgctagctaatgcttcttgattactagtcttattgtgaaaaaatgtcgtctagtgaaactaattttgtgtagtttcgataaatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40076537 |
ggcgtatgaagatgtgctagctaatgcttcttgattactagtcttattgtgaaaaaatgtcgtctagtgaaactaattttgtgtagtttcgataaatgta |
40076438 |
T |
 |
| Q |
201 |
aatttgcatggttgtcaattaagggaataaagcaaagatagtactaaattgggaaaagtgaagcaaaagagtatgaatttttggacaaagtgacacggtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40076437 |
aatttgcatggttgtcaattaagggaataaagcaaagatagtactaaattgggaaaagtgaagcaaaagagtatgaatttttggacaaagtgacacggtg |
40076338 |
T |
 |
| Q |
301 |
gcagctgtgtttt |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40076337 |
gcagctgtgtttt |
40076325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University