View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_46 (Length: 294)
Name: NF1412_high_46
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 50 - 278
Target Start/End: Complemental strand, 6046740 - 6046510
Alignment:
| Q |
50 |
atcatattgaagattcatctctactatttattcat-atttcatacttcttattatttggctagggatgattctcaagtcat-cagtgcattgtgagtgat |
147 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||| | ||||||||| | ||||||||||||||||||| ||||||||||| ||| ||||||| |||||| |
|
|
| T |
6046740 |
atcatattcaagattcatctttactatttgttcattaattcatacttttaattatttggctagggatgactctcaagtcattcagagcattgtcagtgat |
6046641 |
T |
 |
| Q |
148 |
gttttgaaaaagctagccttgatgtatcccaatgaactgaaaggccttgttcataatgatcaacacggtagttatactgagtcactactgaaaagatatc |
247 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6046640 |
gtttggaaaaagctagccttgatgtatcctaatgaactgaaaggccttgttcataacgatcaacacggtagttatactgagtcactgctgaaaagatatt |
6046541 |
T |
 |
| Q |
248 |
caagaattggaatttggggcatgggtggaat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6046540 |
caagaattggaatttggggcatgggtggaat |
6046510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 6062810 - 6062753
Alignment:
| Q |
221 |
atactgagtcactactgaaaagatatccaagaattggaatttggggcatgggtggaat |
278 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6062810 |
atactgaatcactactgaaaaagtatcaaagaattggaatttggggcatgggaggaat |
6062753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 6087989 - 6087931
Alignment:
| Q |
220 |
tatactgagtcactactgaaaagatatccaagaattggaatttggggcatgggtggaat |
278 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
6087989 |
tatactgaatcactactgaaaaagtatcaaagaattggaatatggggcatgggaggaat |
6087931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University