View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_53 (Length: 266)
Name: NF1412_high_53
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 260
Target Start/End: Complemental strand, 5947242 - 5946995
Alignment:
| Q |
19 |
tcttttccgttcaaaaaaccgttattccctccgaaacagatcggaaaattacttccaccgtc------gccggtaagcgatccacttctcattcgttttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5947242 |
tcttttccgttcaaaaaaccgttattccctccgaaacagatcggaaaattacttccaccgtcaccgtcgccggtaagcgatccacttctcattcgttttt |
5947143 |
T |
 |
| Q |
113 |
catttcttgtatcaacgccgctatcatgcttctgcattgtttacaaatcacctcaatctgttgcatcaatgaaaactccattttcagatctctctgttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5947142 |
catttcttgtatcaacgccgctatcatgcttctgcattgtttacaaatcacctcaatctgttgcatcaatgaaaactccattttcagatctctctgttta |
5947043 |
T |
 |
| Q |
213 |
atttccaatgctcatgtttttgcactgttttgattcgattcatctcac |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5947042 |
atttccaatgctcatgtttttgcactgttttgattcgattcatttcac |
5946995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University