View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_54 (Length: 260)
Name: NF1412_high_54
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 102 - 250
Target Start/End: Complemental strand, 27159014 - 27158866
Alignment:
| Q |
102 |
tcaatgcattgtacctggacaagagcaggaggaatagttgcatattctagaatttctgaaannnnnnncacaccaaaattgctgagaccaatagacttag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
27159014 |
tcaatgcattgtacctggacaagagcaggaggaatagttgcatattctagaatttctgaaatttttttcacaccaaaattgctaagaccaatagacttag |
27158915 |
T |
|
| Q |
202 |
ccaagcccagattagcacattgttccatatccttccatgtccctttcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27158914 |
ccaagcccagattagcacattgttccatatctttccatgtccctttcat |
27158866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 58
Target Start/End: Complemental strand, 27159134 - 27159091
Alignment:
| Q |
15 |
atcaaatacattaggtatatcagtagctaaatttttaaatggtt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27159134 |
atcaaatacattaggtatatcagtagctacatttttaaatggtt |
27159091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 59
Target Start/End: Complemental strand, 27159091 - 27159062
Alignment:
| Q |
30 |
tatatcagtagctaaatttttaaatggttt |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27159091 |
tatatcagtagctaaatttttaaatggttt |
27159062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University