View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_70 (Length: 249)
Name: NF1412_high_70
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_70 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 3137564 - 3137803
Alignment:
| Q |
10 |
attattctaaaaaccatgtaagtggagcaagatccatagggtttggcataaagggagccacatggtcccctaaaatggacaatttgccaaccnnnnnnnt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3137564 |
attattctaaaaaccatgtaagtggagcaagatccatagggtttggcataaagggagccacatggtcccctaaaatggacaatttgccaaccaaaaaaat |
3137663 |
T |
|
| Q |
110 |
acacatcccactgatccacaccctaaccattatcaaattttgggaccattaatcaaagtcaccattatttatttttgatagtctttttcccacgcctaat |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3137664 |
acacatcccactgatccacactctaaccattatcaaattttgggacccttaatcaaagtcaccattatttatttttgatagtctttttcccacgcctaat |
3137763 |
T |
|
| Q |
210 |
ttcaccccatgattaatttctcctaacccacacatgcaca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3137764 |
ttcaccccatgattaatttctcctaacccacacatgcaca |
3137803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University