View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_71 (Length: 249)
Name: NF1412_high_71
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 64 - 241
Target Start/End: Complemental strand, 49646749 - 49646572
Alignment:
| Q |
64 |
tttatagacacccaaaactcatatacttctcgagcaagataggaataaaagagattgatgtaataggaagagaaagatnnnnnnnnnnttgttgaatgaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
49646749 |
tttatagacacccaaaactcatatacttctcgagcaagataggaataaaagagattgatgtgataggaagagaaagataaaaaaaaaattgttgaatgaa |
49646650 |
T |
 |
| Q |
164 |
tgtatgaagtttatgggtgatcaaatatatgagtagtaaaagtaagtaagtctttgatgtcaataatgttttcatctc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49646649 |
tgtatgaagtttatgggtgatcaaatatatgagtagtaaaagtaagtaagtctttgatgtcaataatgttttcatctc |
49646572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 49646812 - 49646775
Alignment:
| Q |
1 |
tgtcacacaaccatatattagttctatctgcctcaagt |
38 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |
|
|
| T |
49646812 |
tgtcacacaaacagatattagttctatctgcctcaagt |
49646775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University