View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_79 (Length: 244)
Name: NF1412_high_79
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_79 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 13923776 - 13923541
Alignment:
| Q |
10 |
attatactggtacaaattaattccaataagaaatttggtacaatatgaaatccacttgatactctactatcagtctagaattggttggcctagtttggtt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13923776 |
attagactggtacaaattaattccaataagaaatttggtacaatatgaaatccacttgatactctactatcagtgtagaattggttggcctagtttggtt |
13923677 |
T |
 |
| Q |
110 |
aatttcaagtagttgaaaatgatcgatctagacattaatgaatggaagaaaaaccccaacatatttttagtgaacctcttctagttgcaactagctaggc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13923676 |
aatttcaagtagttgaaaatgatcgatctagacattaatgaatggaagaaaaaccccaacatatttttagtgaacctcttctagttgcaactagctagga |
13923577 |
T |
 |
| Q |
210 |
aatttccttcaatctaaatag-ccgattgctgtgta |
244 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| |
|
|
| T |
13923576 |
aatttccttcaatctaaatagcccaattgctgtgta |
13923541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University