View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_86 (Length: 236)
Name: NF1412_high_86
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_86 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 21216515 - 21216596
Alignment:
| Q |
10 |
cgaagaaaatgtaactccaaaaagagtctctttcatcctatcattatgacatgcaccatcaataacgttgaatttgctcgga |
91 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
21216515 |
cgaagagaatgtagctccaaaaagagtctctttcatcctatcagcatgacatgcgccatcaataacgtcgaatttactcgga |
21216596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University