View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1412_high_95 (Length: 234)

Name: NF1412_high_95
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1412_high_95
NF1412_high_95
[»] chr1 (1 HSPs)
chr1 (104-219)||(29319717-29319832)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 29319832 - 29319717
Alignment:
104 taccatttacttttgtcctttaaaataaacttcattcatttttctgaaataaaataattaatatgtagaagttaaaatttgaactccagattcttcacta 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
29319832 taccatttacttttgtcctttaaaataaacttcattcatttttctgaaataaaataattaatatgtagaagttaaagtttgaactccagattcttcacta 29319733  T
204 aatgtgtgtgaattca 219  Q
    ||||||||||| ||||    
29319732 aatgtgtgtgagttca 29319717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University