View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_high_97 (Length: 227)
Name: NF1412_high_97
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_high_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 52152 - 52349
Alignment:
| Q |
17 |
cagaagtgatgcatgcaaattcttgttaattgatgatagttgaagaattttagcaaaatgggtggagattttttgtcaatgtttcatctagaaacaaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52152 |
cagaagtgatgcatgcaaattcttgttaattgatgatagttgaagaattttagcaaaatgggtggagattttttgtcaatgtttcatctagaaacaaaga |
52251 |
T |
 |
| Q |
117 |
gattaatatggcttattggaattactttttcaataatcttagcttttcagtatgttgaaccaaattatggcaatgttctactctctctattctctgct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52252 |
gattaatatggcttattggaattactttttcaataatcttagcttttcagtatgttgaaccaaattatggcaatgttcttctctctctattctctgct |
52349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University