View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_101 (Length: 236)
Name: NF1412_low_101
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 29622637 - 29622727
Alignment:
| Q |
134 |
atataggaaaacttaacttacaaattatgtcga-at---atagttattgagtttctttgtatactacttatgagttggttctatattgttt |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29622637 |
atataggaaaacttagcttacaaattatgtcgatatataataattattgagtttctttgtatactacttatgagttggttctacattgttt |
29622727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 29598849 - 29598935
Alignment:
| Q |
134 |
atataggaaaacttaacttacaaattatgtcgaatatagttattgagtttctttgtatactacttatgagttggttctatattgttt |
220 |
Q |
| |
|
||||| |||||||||||||||| ||||||| || | |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29598849 |
atatatgaaaacttaacttacagattatgtgatttaaaattattgagtttctttgtatactacttataagttggttctatattgttt |
29598935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University