View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1412_low_101 (Length: 236)

Name: NF1412_low_101
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1412_low_101
NF1412_low_101
[»] chr1 (2 HSPs)
chr1 (134-220)||(29622637-29622727)
chr1 (134-220)||(29598849-29598935)


Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 29622637 - 29622727
Alignment:
134 atataggaaaacttaacttacaaattatgtcga-at---atagttattgagtttctttgtatactacttatgagttggttctatattgttt 220  Q
    ||||||||||||||| ||||||||||||||||| ||   ||| |||||||||||||||||||||||||||||||||||||||| |||||||    
29622637 atataggaaaacttagcttacaaattatgtcgatatataataattattgagtttctttgtatactacttatgagttggttctacattgttt 29622727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 29598849 - 29598935
Alignment:
134 atataggaaaacttaacttacaaattatgtcgaatatagttattgagtttctttgtatactacttatgagttggttctatattgttt 220  Q
    ||||| |||||||||||||||| |||||||    || | |||||||||||||||||||||||||||| |||||||||||||||||||    
29598849 atatatgaaaacttaacttacagattatgtgatttaaaattattgagtttctttgtatactacttataagttggttctatattgttt 29598935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University