View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_111 (Length: 226)
Name: NF1412_low_111
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_111 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 40297034 - 40296813
Alignment:
| Q |
5 |
caaccatgtggtattctttgctactgtcaaccatgtcttactgaacaaagacctgcaaacaaaataaaaagacgannnnnnnnnnnnccagatttgtata |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40297034 |
caaccatgtggtattctttgctactgtcaaccatgtcttacagaacaaagacctgcaaacaaaataaaaagacgattttttgtttttccagatttgtata |
40296935 |
T |
 |
| Q |
105 |
tgaaagtaagtgcttttctcaaatggctttaacagctctaaaccttggttccttggggaggaacttctgctcagcatagacagacatgtagtcaccgaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40296934 |
tgaaagtaagtgcttttctcaaatggctttaacagctctaaaccttggttccttggggaggaacttctgctcagcatagacagacatgtagtcaccgaaa |
40296835 |
T |
 |
| Q |
205 |
acaaacttaggataagtgtcat |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40296834 |
acaaacttaggataagtgtcat |
40296813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University